Distinguishing between filaments using molecular tools
Molecular tools such as next-generation sequencing and qPCR can help us distinguish between filaments, but how, really, do we do that? How about a real-world example? I collected the 16S rRNA gene sequences for several different wastewater filaments from the NCBI database. A single 16S rRNA gene (in this case, for S. natans), looks like this: >Sphaerotilus natans
CAATCCTCGAGAGTGGCGAACGGGTGAGTAATACATCGGAACGTGCCCAGTCGTGGGGGATAACGTAGCGAAACTACGCTAATACCGCATACGACCCGAGGGTGAAAGCGGGGG